View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10236_low_20 (Length: 256)
Name: NF10236_low_20
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10236_low_20 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 118 - 256
Target Start/End: Original strand, 34344406 - 34344544
Alignment:
| Q |
118 |
atttcaagtttgtggacaaaaaacggagtaagaatttaaatagaaactaggttgtagcactttctataatgaattcgaaaactgaaatgataatgaccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344406 |
atttcaagtttgtggacaaaaaacggagtaagaatttaaatagaaactaggttgtagcactttctataatgaattcgaaaactgaaatgataatgaccaa |
34344505 |
T |
|
| Q |
218 |
acaacattgtgggaggagaagaaggtatgagacaaactc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344506 |
acaacattgtgggaggagaagaaggtatgagacaaactc |
34344544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 34344289 - 34344340
Alignment:
| Q |
1 |
gaattgagtatggaaaggaacgaaataaagattggtttttgattaaagatat |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344289 |
gaattgagtatggaaaggaacgaaataaagattggtttttgattaaagatat |
34344340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University