View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10236_low_26 (Length: 229)
Name: NF10236_low_26
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10236_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 30289211 - 30289012
Alignment:
| Q |
13 |
cagagaaggagattgtttatatttttaagccttaatatatggaatctttgcacttgaaatgtttaatatgtcatatggtattcctagtatcactaaaata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30289211 |
cagagaaggagattgtttatatttttaagccttaatatatggaatctttgcacttgaaatgtttaatatgtcatatggtattcccagtatcactaaaata |
30289112 |
T |
 |
| Q |
113 |
caatatttaattttgtaaactaattaagacatgtcaaaatatttctccttttattgaaaaaaggaaatgataaaaagaatatgttatagtttcaacttac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30289111 |
caatatttaattttgtaaactaattaagacatgtcaaaatatttctccttttattgaaaaaaggaaatgatacaaagaatatgttatagtttcaacttac |
30289012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University