View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10236_low_28 (Length: 229)
Name: NF10236_low_28
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10236_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 229
Target Start/End: Complemental strand, 31923573 - 31923351
Alignment:
| Q |
10 |
ttgagatgagttattt-agttttagtttgtg--gtagatattgaatatgaaaacatagtacagaacttgatttgacgtatataaaacaacctcgattaga |
106 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31923573 |
ttgagatgagttgttttagttttagtttgtgtggtagatattgaatatgaaaacatagtacagaacttgatttgacatatataaaacaacctcgattaga |
31923474 |
T |
|
| Q |
107 |
cctattaatgtaaacatgcatggatgttattattagatgcaaaattatatcgtttcatcatttggaaatctatgaagacaagttcattcaacagggccat |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31923473 |
cctattaatgtaaacatacatggatgttattattagatgcaaaattatatcgtttcatcatttggcaatctatgaagacaagttcattcaacagggccat |
31923374 |
T |
|
| Q |
207 |
ttgatggtgaattgcgtctgttt |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31923373 |
ttgatggtgaattgcgtctgttt |
31923351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University