View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10236_low_30 (Length: 217)
Name: NF10236_low_30
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10236_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 33829228 - 33829412
Alignment:
| Q |
15 |
atgaactatattagcattcaaattttaatcgtgaaaaagctcgactcaaatactatgaaactcgaaaaatacatgttttaacatgttgaatatatgcttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33829228 |
atgaactatattagcattcaaattttaatcgtgaaaaagctcgactcaaatactatgaaactcgaaaaatacatgttttaacttgttgaatatatgcttg |
33829327 |
T |
 |
| Q |
115 |
agatgagtataatcatacgacggtccaatatcaaaagattttttagacctgcataaattatgcagtttgattttccaactaattg |
199 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33829328 |
agatgagcataatcttacgacggtccaatatcaaaagattttttagggctgcataaattatgcagtttgattttccaactaattg |
33829412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University