View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10237_high_14 (Length: 237)

Name: NF10237_high_14
Description: NF10237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10237_high_14
NF10237_high_14
[»] chr6 (1 HSPs)
chr6 (109-210)||(2739535-2739636)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 109 - 210
Target Start/End: Original strand, 2739535 - 2739636
Alignment:
109 tgagaaaccacaaaaccaatcaccatctaatactctaacaagaccaccgcaaccttctctgccatcatgcttactagaaccatttgtattgagtttaatc 208  Q
    ||||||||  ||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2739535 tgagaaacttcaaaatcaatcaccatctaatactcgaacaaggccaccgcaaccttctctgccatcatgcttactagaaccatttgtattgagtttaatc 2739634  T
209 ct 210  Q
    ||    
2739635 ct 2739636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University