View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10237_low_2 (Length: 410)
Name: NF10237_low_2
Description: NF10237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10237_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 22866685 - 22866401
Alignment:
| Q |
1 |
tcataatattatttggtcatgtagctggtttcatcaatatgggtgaaaatgtctttggttgttctatttttgaacttttgaatgattcaaatatcacctt |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
22866685 |
tcataatattatttggtcacgtagctggtttcatcaatatgggtgaaaatgtctttggttgttctattttagaacttttgaataattcaaatatcacctt |
22866586 |
T |
 |
| Q |
101 |
gattgtgtactttaaattttagaccatgcgttcataagtatgtcatatgatttccaattctacacatttgaatcttgacaattgcttcttagctatgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22866585 |
gattgtgtactttaaattttagaccatgcgttcataagtatgtcatatgatttccaattctacacatttgaatcttgacaattgcttcttagctatgttg |
22866486 |
T |
 |
| Q |
201 |
ttaatcgcggatagcaatagctgctgctgtaaagactaaaaacaacgtacaaaatacctaaattccaataggagacatagacact |
285 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
22866485 |
ttaatcgcggatagcaatagcttctgctgtaaagactaaaaacaacgtacaaactacttaaattccaataggatacatagacact |
22866401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 314 - 402
Target Start/End: Complemental strand, 22866358 - 22866269
Alignment:
| Q |
314 |
tcacctttgctccccaaggatcgcgattgtgcgattttggctcgtca-nnnnnnnggagcgatcttggcccttcatgttttcctcctttg |
402 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22866358 |
tcacttttgctccccaaggatcgcgattgtgcgattttggctcgtcattatttttggagcgatcttggcccttcatgttttcctcctttg |
22866269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University