View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10237_low_22 (Length: 237)
Name: NF10237_low_22
Description: NF10237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10237_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 109 - 210
Target Start/End: Original strand, 2739535 - 2739636
Alignment:
| Q |
109 |
tgagaaaccacaaaaccaatcaccatctaatactctaacaagaccaccgcaaccttctctgccatcatgcttactagaaccatttgtattgagtttaatc |
208 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2739535 |
tgagaaacttcaaaatcaatcaccatctaatactcgaacaaggccaccgcaaccttctctgccatcatgcttactagaaccatttgtattgagtttaatc |
2739634 |
T |
 |
| Q |
209 |
ct |
210 |
Q |
| |
|
|| |
|
|
| T |
2739635 |
ct |
2739636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University