View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10237_low_6 (Length: 342)
Name: NF10237_low_6
Description: NF10237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10237_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 3e-82; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 31174436 - 31174253
Alignment:
| Q |
9 |
agcaaaggagggcttgacttggatatggatgtctttgacctgcttgacacatctggggatggcaatgctcaaggttaccttttggtggattatgaatttg |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31174436 |
agcaatggagggcttgacttggatatggatgtctttgacctgcttgacacatctggggatggcaatgctcaaggttaccttttggtggattatgaatttg |
31174337 |
T |
|
| Q |
109 |
tggactgtggtactactatttatttatctcttttaccttattatagttctaatttcaataaaagaaatcatcgacatagttgttttta |
196 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
31174336 |
tggactgtggtactac----tacttatctcttttaccttattatagttctaatttcaataaaaaaaatcatccacatagttgttttta |
31174253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 76 - 153
Target Start/End: Complemental strand, 31191744 - 31191671
Alignment:
| Q |
76 |
ctcaaggttaccttttggtggattatgaatttgtggactgtggtactactatttatttatctcttttaccttattata |
153 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
31191744 |
ctcaaggttacctcgtggtggattatgaatttgtggattgtggtactac----taattatctcttttaccctattata |
31191671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 119
Target Start/End: Complemental strand, 31142377 - 31142330
Alignment:
| Q |
72 |
aatgctcaaggttaccttttggtggattatgaatttgtggactgtggt |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
31142377 |
aatgctcaaggttaccttatggtggattatgaatttgtggattgtggt |
31142330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 15 - 153
Target Start/End: Complemental strand, 31205671 - 31205537
Alignment:
| Q |
15 |
ggagggcttgacttggatatggatgtctttgacctgcttgacacatctggggatggcaatgctcaaggttaccttttggtggattatgaatttgtggact |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||| | ||||||||| ||| | || | ||||||||||||| |||||||||| ||||||||| ||| |
|
|
| T |
31205671 |
ggagggcttgaattggatatggatgtctttcaaaagcttgacaccagtggttacgggatgtctcaaggttacctcgtggtggattacgaatttgtgaact |
31205572 |
T |
|
| Q |
115 |
gtggtactactatttatttatctcttttaccttattata |
153 |
Q |
| |
|
|||||||||| || |||||||||||||| ||||||| |
|
|
| T |
31205571 |
gtggtactac----taattatctcttttaccctattata |
31205537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 292 - 322
Target Start/End: Complemental strand, 31173832 - 31173802
Alignment:
| Q |
292 |
gtaaatattacaaacaatttgatgagtgaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31173832 |
gtaaatattacaaacaatttgatgagtgaat |
31173802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University