View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1023R-Insertion-4 (Length: 124)
Name: NF1023R-Insertion-4
Description: NF1023R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1023R-Insertion-4 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 3e-52; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 124
Target Start/End: Complemental strand, 1630069 - 1629949
Alignment:
| Q |
8 |
agataggtttataatatttaaattatacttgaggctttcttacat----acaattactttcattttttattttaaataattactcttggatcatttaaat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1630069 |
agataggtttataatatttaaattatacttgaggctttcttacatgcatacaattactttcattttttattttaaataattactcttggatcatttaaat |
1629970 |
T |
|
| Q |
104 |
ttaggtattgatggacttcac |
124 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1629969 |
ttaggtattgatggacttcac |
1629949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 124
Target Start/End: Original strand, 10820637 - 10820749
Alignment:
| Q |
8 |
agataggtttataatatttaaattatacttgaggctttcttacatacaattactttcattttttattttaaataattactcttggatcatttaaatttag |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10820637 |
agataggtttataatatttaaattataattgtggctttcttacctacaattactttcatatttt----taaataattactcttggatcatttaaatttag |
10820732 |
T |
|
| Q |
108 |
gtattgatggacttcac |
124 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10820733 |
gtattgatggacttcac |
10820749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 86 - 124
Target Start/End: Complemental strand, 1606689 - 1606651
Alignment:
| Q |
86 |
ctcttggatcatttaaatttaggtattgatggacttcac |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1606689 |
ctcttggatcatttaaatttaggtattgatggacttcac |
1606651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University