View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1023_high_3 (Length: 282)
Name: NF1023_high_3
Description: NF1023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1023_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 79 - 233
Target Start/End: Original strand, 49471899 - 49472053
Alignment:
| Q |
79 |
ccatcacccaccccgtagaaagaatgtgaccttgtgcgactattagtggaaagcgacatgatctgatctggacaattaaatttcaacttgaaggaaagaa |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49471899 |
ccatcacccaccccgtagaaagaatgtgaccttgtgcgactattagtggaaagcgacatgatctgatctggacaattaaatttcaacttgaaggaaagaa |
49471998 |
T |
|
| Q |
179 |
ggaaggaaccccgttttctcctgtactctactgtttctttaattatcactcactc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49471999 |
ggaaggaaccccgttttctcctgtactctactgtttctttaattatcactcactc |
49472053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University