View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1023_low_15 (Length: 239)
Name: NF1023_low_15
Description: NF1023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1023_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 35762321 - 35762482
Alignment:
| Q |
1 |
cattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattttgcagtgtatagaggccgtttctgtgnnnnnnnaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35762321 |
cattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattttgcagtgtatagaggccgtttctgtgtttttttaa |
35762420 |
T |
|
| Q |
101 |
cagcataatttttgttgttgtttggtttctggtcagcctacggcgccggcctttggtggagg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762421 |
cagcataatttttgttgttgtttggtttctggtcagcctacggcgccggcctttggtggagg |
35762482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University