View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1023_low_8 (Length: 361)
Name: NF1023_low_8
Description: NF1023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1023_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 85 - 267
Target Start/End: Complemental strand, 6625977 - 6625795
Alignment:
| Q |
85 |
atgaaggaagcagacatattttttgatgatccaaaatctgccgagagtataaagcagttagaacaggttttcatccatcacttggttgttaatgctgttt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6625977 |
atgaaggaagcagacatattttttgatgatccaaaatctgccgagagtataaagcagttagaacaggttttcatccatcacttggttgttaatgctgttt |
6625878 |
T |
|
| Q |
185 |
atttattatctgtatggtgtatgaagtatgtacatttaaattcactatctgttttatttgttctgtctgttggtgtggacact |
267 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6625877 |
atttattatatgtatggtgtatgaagtatgtacatttaaattcactatctgttttatttgttctgtctgttggtgtggacact |
6625795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University