View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1023_low_9 (Length: 341)
Name: NF1023_low_9
Description: NF1023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1023_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 87 - 331
Target Start/End: Original strand, 43028606 - 43028849
Alignment:
| Q |
87 |
actattttattatcattgtaccaaggnnnnnnnnttagaataataaataatacaattacatctctaatttcctttacatct--atttaacacctcatttt |
184 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43028606 |
actattttattatcattgtaccaaggaaaaaaaattataataataaataatacaattacatctctaatttcctttacatctctatttaacacctcatttt |
43028705 |
T |
|
| Q |
185 |
atctctctgtctctctttctattacatcaacaatataattgaacgtcactctattatctctttctttctttttcacgatgtcaaagagttttagatgtcc |
284 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43028706 |
atctctctgtctctctttctgttacatcaacaatataattgaacgtcactctattatc----tctttctttttcacgatgtcaaagagttttagatgtcc |
43028801 |
T |
|
| Q |
285 |
acctattttttct-tgagaaattatgctttaccaactaatgagtataa |
331 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
43028802 |
acctatcttttctctgagaaattatgctttaccaactaattagtataa |
43028849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University