View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10240_low_3 (Length: 313)
Name: NF10240_low_3
Description: NF10240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10240_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 39977243 - 39977439
Alignment:
| Q |
1 |
ctaccttgtaaatcacattttgttatactaggaaaagaacaaggttgatgaggtggtttagatgaaagataagctaaattaaaaccataacttttcattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39977243 |
ctaccttgtaaatcacattttgttatactaggaaaagaacaaggttgatgaggtggtttagatgaaagataagctaaattaaaaccataacttttcattt |
39977342 |
T |
|
| Q |
101 |
ttcttgcagctctatagtatgaatttgcaagtagttggtacaaaaccaaatctacaagccttagaagaaccattggaaacatcatgataaatatttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39977343 |
ttcttgcagctctatagtatgaatttgcaagtagttggtacaaaaccaaatctacaagccttagaagaaccattggaaacatcatgataaatatttc |
39977439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 218 - 298
Target Start/End: Original strand, 39977475 - 39977555
Alignment:
| Q |
218 |
ttttgttgttgatttttgagaaagcaaaaagtaaatagaaagattaaggataggaattggaaatgtgtgtgtctgtctgtg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39977475 |
ttttgttgttgatttttgagaaagcaaaaagtaaatagaaagattaaggataggaattggaaatgtgtgtgtctgtctgtg |
39977555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University