View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10240_low_7 (Length: 239)
Name: NF10240_low_7
Description: NF10240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10240_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 54 - 142
Target Start/End: Original strand, 2377195 - 2377280
Alignment:
| Q |
54 |
caaagggatttacattagctttgacaatgttggggggaaacatgcataaggaaacccttcttaacacgagaaaacgatgttgaagtatc |
142 |
Q |
| |
|
|||||| ||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
2377195 |
caaaggcattgacattaactttgacaatgttggggg--aacatgcataaggaaacccttcttaacaagagaaaacg-tgttgaagtatc |
2377280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 140 - 218
Target Start/End: Original strand, 2377301 - 2377380
Alignment:
| Q |
140 |
atcctacagtttggcactcattcgtgtgcaggata-tacaactttacctcttgcttagtgccgaaattacacaaacgcct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| || | | ||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
2377301 |
atcctacagtttggcactcattcgtgtgctggctggtgcaactttacctctagctcagtgccgaaattacacaaacgcct |
2377380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 54 - 140
Target Start/End: Complemental strand, 1522829 - 1522745
Alignment:
| Q |
54 |
caaagggatttacattagctttgacaatgttggggggaaacatgcataaggaaacccttcttaacacgagaaaacgatgttgaagta |
140 |
Q |
| |
|
|||||| ||| |||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
1522829 |
caaaggcattgacattaactttgacaatgttggggg--aacatgcataaggaaacccttattaacacgagaaaatgttgttgaagta |
1522745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 5 - 64
Target Start/End: Complemental strand, 1523785 - 1523727
Alignment:
| Q |
5 |
tgtctgttgaaaggacttcctttgctccctaggtcattcttggaagcttcaaagggattt |
64 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1523785 |
tgtctgttgaaaggacttcctt-gctccctaggtcattcttggaagcttcaaagggattt |
1523727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 218
Target Start/End: Original strand, 35726310 - 35726380
Alignment:
| Q |
149 |
tttggcactcattcgtgtgcaggat-atacaactttacctcttgcttagtgccgaaattacacaaacgcct |
218 |
Q |
| |
|
|||||||||||||||| |||||| | || ||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
35726310 |
tttggcactcattcgtatgcaggctgatgcaactttacctcttgctcagcgccgaaactacacaaacgcct |
35726380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University