View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10241_low_12 (Length: 233)
Name: NF10241_low_12
Description: NF10241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10241_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 42274087 - 42273885
Alignment:
| Q |
18 |
gaagacaccttgggttattacaatggttcatgcaccttggtatactactaatgaggcacatcaaggtgaaggtgaatccatgagacaagctatggaagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42274087 |
gaagacaccttgggttattacaatggttcatgcaccttggtatactactaatgaggcacatcaaggtgaaggtgaatccatgagacaagctatggaagag |
42273988 |
T |
|
| Q |
118 |
ttgctttttaaggctcgtgttgatttggtttttgctggacatgttcatgcgtatgaacgatttgtatgtcatgtttttcactactattgttttgtttatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42273987 |
ttgctttttaaggctcgtgttgatttggtttttgctggacatgttcatgcgtatgaacgatttgtatgtcatgtttttcactactattgttttgtttatt |
42273888 |
T |
|
| Q |
218 |
cat |
220 |
Q |
| |
|
||| |
|
|
| T |
42273887 |
cat |
42273885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 26276179 - 26276346
Alignment:
| Q |
22 |
acaccttgggttattacaatggttcatgcaccttggtatactactaatgaggcacatcaaggtgaaggtgaatccatgagacaagctatggaagagttgc |
121 |
Q |
| |
|
||||||||||| ||| | |||| |||||||||||||||| |||||||||||||||| |||||||||||||| |||||||| || |||||||| |||| |
|
|
| T |
26276179 |
acaccttgggtgattgccttggtacatgcaccttggtataatactaatgaggcacatgaaggtgaaggtgaagaaatgagacaggccatggaagaattgc |
26276278 |
T |
|
| Q |
122 |
tttttaaggctcgtgttgatttggtttttgctggacatgttcatgcgtatgaacgatttgtatgtcat |
189 |
Q |
| |
|
||| | ||||||||||||| ||||||||| | || ||||| ||||| || ||||| |||||||||||| |
|
|
| T |
26276279 |
tttatgaggctcgtgttgacttggttttttcagggcatgtccatgcatacgaacgctttgtatgtcat |
26276346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 176
Target Start/End: Complemental strand, 40335544 - 40335502
Alignment:
| Q |
134 |
gtgttgatttggtttttgctggacatgttcatgcgtatgaacg |
176 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
40335544 |
gtgttgatttagttcttgctggacatgttcatgcttatgaacg |
40335502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University