View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10241_low_8 (Length: 278)
Name: NF10241_low_8
Description: NF10241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10241_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 254
Target Start/End: Complemental strand, 14421616 - 14421374
Alignment:
| Q |
12 |
atggacatcaaaaggaatttcagctaattgaccttataaggaattaaaatattgttcattataatgcaaattatggtgagtattgttcaacatcgcagtc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14421616 |
atggccatcaaaaggaatttcagctaattgaccttataaggaattaaaatattgttcattataatgcaaattatggtgagtattgttcaacatcgcagtc |
14421517 |
T |
|
| Q |
112 |
acaggaccatcttgcacgaggaggagatggaaaattgaagcagagtcacgaccatggtgttgggttaaagagaatatttgtgccttaaagccctacattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14421516 |
acaggaccatcttgcacgaggaggagatggaaaattgaagtagagtcacgaccatggtgttgggttaaagagaatatttgtgccttaaagccctacattt |
14421417 |
T |
|
| Q |
212 |
tttatggctcaattaaaaaccatgttttgattgggtaggatag |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14421416 |
tttatggctcaattaaaaaccatgttttgattgggtaggatag |
14421374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University