View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10242_low_3 (Length: 378)
Name: NF10242_low_3
Description: NF10242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10242_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 19 - 366
Target Start/End: Original strand, 10306772 - 10307119
Alignment:
| Q |
19 |
tctcctccatttccaccaccgctaccgccaccgccaactgtgcagtttgccttaccgcgttcagcaccactgacctcctccgcgctctccctaggtgttg |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306772 |
tctcctccatttccacgaccgctaccgccactgccgactgtgcagtttgccttaccgcgttcagcaccactgacctcctccgcgctctccctaggtgttg |
10306871 |
T |
|
| Q |
119 |
tcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctcatgttgtccgctttgccgttccaccattttcgcttcagaatccgac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10306872 |
tcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctcatgttgtccgctttgccgttccacaattttcgcttcagaatccgac |
10306971 |
T |
|
| Q |
219 |
ctcgcggcgattctccgatcaccttccgacagtttccgagttgaaattggaaatgtgacttatccagaagctgtcggcggagacgcattgtcatcatatt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306972 |
ctcgcggcgattctccgatcaccttccgacagtttccgagttgaaattggaaatgtgacttatccagaagctgtcggcggagacgcattgtcatcatatt |
10307071 |
T |
|
| Q |
319 |
ccattggaggatcattcgattatcgtgtaatggaggtatcacaggttc |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10307072 |
ccattggaggatcattcgattatcgtgtaatggaggtatcgcaggttc |
10307119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 163 - 276
Target Start/End: Original strand, 1722082 - 1722195
Alignment:
| Q |
163 |
ccaacctctcatgttgtccgctttgccgttccaccattttcgcttcagaatccgacctcgcggcgattctccgatcaccttccgacagtttccgagttga |
262 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1722082 |
ccaacctctcatgttgtcggctctgccattccaccattttcgcttcagaattcgacctcgccgcgattctccgatcaccttccgacagtttccgagatga |
1722181 |
T |
|
| Q |
263 |
aattggaaatgtga |
276 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1722182 |
aattggaaatgtga |
1722195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University