View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10242_low_7 (Length: 257)
Name: NF10242_low_7
Description: NF10242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10242_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 41025911 - 41025674
Alignment:
| Q |
1 |
aacaacaactcctaattattttagtaatcatcatggatagtttatgttggctgagacgtcgtgaaaatgtgctagacactctctcatcaaagggaagttt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41025911 |
aacaacaactcctaattatttcggtaatcatcatggatagtttatgttggctgagacgtcgtgaaaatgtgctagacactctctcatcgaagggaagttt |
41025812 |
T |
 |
| Q |
101 |
gttgcattatttgagtcgatga-gatagtgtacagtaaagacgttgatcgtgttgtgtttgagagtgattctcaaattttactaaatgttgtttacatta |
199 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41025811 |
gttgcattatttgagttgatgaggatagtgtccagtaaagacgttgctcgtgttgtgtttgagagtgattctcaaattttactaaatgttgtttacatta |
41025712 |
T |
 |
| Q |
200 |
ataattaaagcttactttaatgctattgtttctagtat |
237 |
Q |
| |
|
|| ||| | ||||||||||||| ||||||||||||||| |
|
|
| T |
41025711 |
atgattgaggcttactttaatgttattgtttctagtat |
41025674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University