View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10243_high_3 (Length: 240)
Name: NF10243_high_3
Description: NF10243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10243_high_3 |
 | |
|
| [»] chr1 (9 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 16252161 - 16251939
Alignment:
| Q |
18 |
tcaactaggcatggcataagggcatggttaggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggttcat |
117 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16252161 |
tcaactagacatggcataagggtatggttaggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggttcat |
16252062 |
T |
|
| Q |
118 |
ctgcaacacttaatttttcagttgaaacggttaaggaatcacttagggacatgaattatttgttgtctaatgataatgagtgttcacctgttattgcttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16252061 |
ctgcaacacttaatttttcagttgaaaaggttaaggaatcacttagggacatgaattatttgttgtctaatgataatgagtgttcacctgttattgcttt |
16251962 |
T |
|
| Q |
218 |
gaagagacaacattcaatgaaac |
240 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
16251961 |
gaagagaaaacattcaatgaaac |
16251939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 29 - 113
Target Start/End: Complemental strand, 30656742 - 30656658
Alignment:
| Q |
29 |
tggcataagggcatggttaggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggt |
113 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||| || || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30656742 |
tggcaaaagggtttggttaggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggt |
30656658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 46 - 113
Target Start/End: Complemental strand, 30710550 - 30710483
Alignment:
| Q |
46 |
taggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggt |
113 |
Q |
| |
|
|||||||||||||||||||||||| || || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30710550 |
taggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggt |
30710483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 114
Target Start/End: Complemental strand, 30689779 - 30689713
Alignment:
| Q |
48 |
ggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggtt |
114 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30689779 |
ggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggtt |
30689713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 114
Target Start/End: Complemental strand, 30718822 - 30718756
Alignment:
| Q |
48 |
ggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggtt |
114 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30718822 |
ggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggtt |
30718756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 134
Target Start/End: Original strand, 33042611 - 33042699
Alignment:
| Q |
46 |
taggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggttcatctgcaacacttaatttt |
134 |
Q |
| |
|
||||||| ||||||||||| ||||| || || | |||||||||||||| |||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
33042611 |
taggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttttccatgagaggttcttctgcaatactcaatttt |
33042699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 46 - 113
Target Start/End: Complemental strand, 30698667 - 30698600
Alignment:
| Q |
46 |
taggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggt |
113 |
Q |
| |
|
|||||||||||||||||||||||| || || ||||||||||||||||||| || |||||||||||| |
|
|
| T |
30698667 |
taggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattctcaatgagaggt |
30698600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 113
Target Start/End: Complemental strand, 30671884 - 30671819
Alignment:
| Q |
48 |
ggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaatgagaggt |
113 |
Q |
| |
|
||||||||||| |||||||||| || || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30671884 |
ggaacatttgacagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggt |
30671819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 30629568 - 30629514
Alignment:
| Q |
51 |
acatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttttcaa |
105 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| ||||| |||| |
|
|
| T |
30629568 |
acatttgatacagctgaagcagcagctttagcttatgatcaagcagctttatcaa |
30629514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University