View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10243_high_4 (Length: 209)
Name: NF10243_high_4
Description: NF10243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10243_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 10 - 200
Target Start/End: Complemental strand, 14728184 - 14727994
Alignment:
| Q |
10 |
gatggacatcaaattcatttccttggtgtttcacatcttctctcaaagtatgttctatatcagattttcttggaattaaacctgatatcgaagctgtaaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14728184 |
gatggccatcaaattcatttccttggtgtttcacatcttctctcaaagtatgttctatatcagattttcttggaattaaacctgatatcgaagctgtaaa |
14728085 |
T |
|
| Q |
110 |
gtttttgttagaaaatgccacagtcttaggggagatcaacatattctgttcggaattattatcaaaaaatttggaggagcttgctgatgtc |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14728084 |
gtttctgttagaaaatgccacagtcttaggggagatcaacatattctgttcggaattattatcaaaaaatttggaggagcttgcttatgtc |
14727994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 10 - 200
Target Start/End: Original strand, 17595301 - 17595491
Alignment:
| Q |
10 |
gatggacatcaaattcatttccttggtgtttcacatcttctctcaaagtatgttctatatcagattttcttggaattaaacctgatatcgaagctgtaaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17595301 |
gatggccatcaaattcatttccttggtgtttcacatcttctctcaaagtatgttctatttcagattttcttggaattgaacctgatatcgaagctgtaaa |
17595400 |
T |
|
| Q |
110 |
gtttttgttagaaaatgccacagtcttaggggagatcaacatattctgttcggaattattatcaaaaaatttggaggagcttgctgatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17595401 |
gtttttgttagaaaatgccacagtcttaggggagatcaacatatcctgttcggagttattatcaaaaaatttggagaagcttgctgatgtc |
17595491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University