View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10245_low_1 (Length: 351)
Name: NF10245_low_1
Description: NF10245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10245_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 11 - 336
Target Start/End: Complemental strand, 6111475 - 6111149
Alignment:
| Q |
11 |
gaagcataggttgtggagctctagttccatgctttggctgaaaatctagccatgtcaatattttt-ggcagtgatacacatgattttaagccaggagtag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6111475 |
gaagcataggttgtggagctctagttccatgctttggctgaaaatctagccatgtcaatattttttggcagtgatacacatgattttaagccaggagtag |
6111376 |
T |
|
| Q |
110 |
ctctgcatgtttcaattgatattgatgttcactcggttgcacttaacattggtgagtttggtgttccattttccttccttgtaggtagcagcagtatttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111375 |
ctctgcatgtttcaattgatattgatattcactcggttgcacttaacattggtgagtttggtgttccattttccttccttgtaggtagcagcagtatttc |
6111276 |
T |
|
| Q |
210 |
gcaagtctctaaggcttactcacgaagcgcgaaaacaatttgcatctggaaaaataaccaacttgatgactactgatgctgagtcacttcaggtatggtt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111275 |
gcaagtctctaaggcttactcacgaagcgcgaaaacaatttgcatctggaaaaataaccaacttgatgactactgatgctgagtcacttcaggtatggtt |
6111176 |
T |
|
| Q |
310 |
ttcctttcctccctatcatctgatgtc |
336 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6111175 |
ttcctttcctccctatcatctgatgtc |
6111149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University