View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10245_low_2 (Length: 245)
Name: NF10245_low_2
Description: NF10245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10245_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 36288337 - 36288178
Alignment:
Q |
1 |
ccaaacatacgctgaagtaacgttgtaataccaaattccaacgtatcttgaagaagagttgttaaaactgaagaaacccatttcaaatctgagaccttct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36288337 |
ccaaacatacgctgaagtaacgttgtaataccaaattccaacgtatcttgaagaagagttgttaaaactgaagaaacccatttcaaatctgagaccttct |
36288238 |
T |
 |
Q |
101 |
gagaccaaagtggaaccatctttgatagtttggttctgtgtgataaagtttgctgcatgc |
160 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36288237 |
gagaccaaagtggaaccatctttgatagtttggttctgtgtgataaagtttgctgcatgc |
36288178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 12097237 - 12097396
Alignment:
Q |
1 |
ccaaacatacgctgaagtaacgttgtaataccaaattccaacgtatcttgaagaagagttgttaaaactgaagaaacccatttcaaatctgagaccttct |
100 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
12097237 |
ccaaacatacgctgaagtaacgttgtagtaccaaattccaacgtatcttgaagatgaattgttaaaactgaagaaacccatttcaaatttgagaccttct |
12097336 |
T |
 |
Q |
101 |
gagaccaaagtggaaccatctttgatagtttggttctgtgtgataaagtttgctgcatgc |
160 |
Q |
|
|
|||||||||||||||| ||||||||||||||| ||||| |||||| |||||| ||||||| |
|
|
T |
12097337 |
gagaccaaagtggaactatctttgatagtttgattctgcgtgatagagtttgttgcatgc |
12097396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University