View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10248_low_2 (Length: 262)
Name: NF10248_low_2
Description: NF10248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10248_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 5 - 252
Target Start/End: Original strand, 46587969 - 46588217
Alignment:
| Q |
5 |
aatgcctatgactgtattgctggactcaccaagttcattgctgttccatctacacgttccttttaatttagccctcatggcccaattgaatcaagttttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
46587969 |
aatgcctatgactgtattgctggactcaccaagttcattgctgttccatctacacgttccttttaatttaaccctcatggcccaattgaatcaagttatt |
46588068 |
T |
|
| Q |
105 |
tccttttaaggtagttgaattcaatatataaataaaatggatggtttcaatctgttttttctttcctgaagtatcgaaagnnnnnnnnttatgtttttta |
204 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
46588069 |
tccttttaaggtagttgaattcaaaatataaataaaatggatggtttccatctgttttttctttcctggagtatcgaaagaaaaaaaattatgtttttta |
46588168 |
T |
|
| Q |
205 |
ttgtggtttgtg-tacctagaaagaaatgatgatgtatttttgtctctg |
252 |
Q |
| |
|
|||||||||||| |||||||| | | | ||||||||||||||||||||| |
|
|
| T |
46588169 |
ttgtggtttgtgctacctagataaatacgatgatgtatttttgtctctg |
46588217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University