View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10248_low_5 (Length: 224)
Name: NF10248_low_5
Description: NF10248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10248_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 182665 - 182458
Alignment:
| Q |
1 |
acaagtataccaagatgtccaaccatcataagagaaaccacttgaagaagatattgtgaaacagttacagctaccattggagctgccacgaaactcactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
182665 |
acaagtataccaagatgtccaaccatcataagagaaaccacttgaagaagatattgtgaaacagttacagctaccattggagctgcaacgaaactcactt |
182566 |
T |
 |
| Q |
101 |
tcttcaactcttgaacaaatgtactctcaatctc---atcattctttcttatcaatggtgttgtcacctccttactcatctctctagagttgtttttcat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
182565 |
tcttcaactcttgaacaaatgtactctcaatctcatgatcactctttcttatcaatggtgttgtcacctccttactcatctctctagagttgtttttcat |
182466 |
T |
 |
| Q |
198 |
taaatgtg |
205 |
Q |
| |
|
|||||||| |
|
|
| T |
182465 |
taaatgtg |
182458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University