View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10248_low_7 (Length: 206)
Name: NF10248_low_7
Description: NF10248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10248_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 27 - 188
Target Start/End: Complemental strand, 11037489 - 11037327
Alignment:
| Q |
27 |
atgctttgtcaa-tcatactaacccaaatgtccccatcactcgagtcgtgacatagctgtggtcagaatgcagaagcttagcaagaccgaaatcagaaac |
125 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11037489 |
atgctttgtcaaatcatactaacccaaatgtccccatcactcgagtcgtgacatagctgtggtcagaatgcagaagcttagcaagaccgaaatcagaaac |
11037390 |
T |
|
| Q |
126 |
cttagagttccattgacgatcaatgagtatgttgcttgatttcacatctcggtggacgacttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11037389 |
cttagagttccattgacgatcaatgagtatgttgcttgatttcacatctcggtggacgacttt |
11037327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 37 - 179
Target Start/End: Original strand, 29789056 - 29789198
Alignment:
| Q |
37 |
aatcatactaacccaaatgtccccatcactcgagtcgtgacatagctgtggtcagaatgcagaagcttagcaagaccgaaatcagaaaccttagagttcc |
136 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||| || | || |||| | |||||| ||||| ||||||||||| ||||| ||||||| |
|
|
| T |
29789056 |
aatcatacttacccaaatgtccccataactcgagtcgtgacataactattctcggaatttaaaagcttggcaagcccgaaatcagacaccttggagttcc |
29789155 |
T |
|
| Q |
137 |
attgacgatcaatgagtatgttgcttgatttcacatctcggtg |
179 |
Q |
| |
|
|||| ||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
29789156 |
attggcgatcaaggaggatgttacttgatttcacatctcggtg |
29789198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University