View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10250_low_7 (Length: 223)
Name: NF10250_low_7
Description: NF10250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10250_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 29570610 - 29570408
Alignment:
| Q |
1 |
tggaagctagtttgctgacttagcactatgtttacacttttttgtttgacacaagtagtatatttagatcaattatatagcgtataagcgagacaaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
29570610 |
tggaagctagtttgctgacttagcactatgtttacacttttttgtttgacacaagtagtatatttagatcaattatacagcgtataagcgagacaaatat |
29570511 |
T |
|
| Q |
101 |
tgcatcatttgcaaattagttttcactattggatnnnnnnnnnnnnnctttttcaagttgccttgaaatttaaaatgcatgtatagataatatcacatta |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29570510 |
tgcatcatgcgcaaattagttttcactattggat--aaaaaaaaaaacattttcaagttgccttgaaatttaaaatgcatgtatagataatatcacatta |
29570413 |
T |
|
| Q |
201 |
aaacc |
205 |
Q |
| |
|
||||| |
|
|
| T |
29570412 |
aaacc |
29570408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University