View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10251_high_4 (Length: 232)

Name: NF10251_high_4
Description: NF10251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10251_high_4
NF10251_high_4
[»] chr4 (1 HSPs)
chr4 (1-177)||(20713339-20713515)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 20713339 - 20713515
Alignment:
1 ttcctcgtcttcttcacgttcatcgtcgccgtcgacgccgttctccggtggaatcggggccattcggattgttattcccggtggcttcgtcgtcggaaaa 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
20713339 ttcctcgtcttcttcgcgttcatcgtcgccgtcgacgccgttctccggtggaatcggtgccattcggattgttattcccggtggcttcgtcgtcggaaaa 20713438  T
101 gtttgtttaacggtgaaaatttggaaattgcgttgtggcgcagatctgtttcgttgcgctgggaaaatgttcccacg 177  Q
    ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
20713439 gtttgtttaacggtgaaaaattggaaattgcgttgtagcgcagatctgtttcgttgcgctgggaaaatgttcccacg 20713515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University