View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10251_low_11 (Length: 207)
Name: NF10251_low_11
Description: NF10251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10251_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 15187963 - 15187768
Alignment:
| Q |
1 |
tttgtaatgtttttccctggtctgggctatggatcagtttgttgatatatatccatattttatcgaccccaactatatcgtggtcccacaatgcgcaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15187963 |
tttgtaatgtttttccctggtctgggctatggatcagtttgttgatatatatccatattttatcgaccccaactatatcgtggtcacacaatgcgcaacc |
15187864 |
T |
 |
| Q |
101 |
tagttcattcctgggaaggcccgaatatcacaagataattacaagaccnnnnnnnatcgcctagaggtggataacatgcccttaagcctctatgac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
15187863 |
tagttcattcctgggaaggcccgaatatcacaagataattacaagacctttttttatcgcctagaggtgtataacatgcccttaagcccctatgac |
15187768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 61
Target Start/End: Complemental strand, 15188054 - 15187996
Alignment:
| Q |
3 |
tgtaatgtttttccctggtctgggctatggatcagtttgttgatatatatccatatttt |
61 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
15188054 |
tgtaatgttttttcctggtctgggctatgtatcattttgttgatacatatccatatttt |
15187996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University