View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10251_low_5 (Length: 260)
Name: NF10251_low_5
Description: NF10251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10251_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 3638989 - 3638740
Alignment:
| Q |
1 |
tgtgtttaaacgggtcggtccggtttattatgcaaataaaattacccggttttgtttccaaaaacacttttgcctcctaagttcatagcttcttcaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3638989 |
tgtgtttaaacgggtcggtccggtttattatgcaaataaaattacccggttttgtttccaaaaacacttttgcctcctaagttcatagcttcttcaatta |
3638890 |
T |
|
| Q |
101 |
cctctcgtacactgtacgagattcttagtgcaattcgattttgctcatttgaactcttgtattcgtttttgtgtgccagtagcgtgtgattctgtgaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3638889 |
cctctcgtacactgtacgagattcttagtacaattcgattttgctcatttaaactcttgtattcgtttttgtctgccagtagcgtgtgattctgtgaaat |
3638790 |
T |
|
| Q |
201 |
ttgttggatagtttgattcaggagaaaaggtttgtagttttatgcctatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3638789 |
ttgttggatagtttgattcaggagaaaaggtttgtagttttatgcctatg |
3638740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University