View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10251_low_7 (Length: 240)
Name: NF10251_low_7
Description: NF10251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10251_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 9047678 - 9047904
Alignment:
| Q |
1 |
ttgtcaacattgctcatatctgtgtaaaatttgcgtaccttggatataaacgattttacatgcatgtaactacacaaattgtcatacacatatgcagtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9047678 |
ttgtcaacattgctcatatctgtgtaaaatttgtgtaccttggatataaacgattttacatgcatgtaactacacaaattgtcatacacatgtgcagtta |
9047777 |
T |
|
| Q |
101 |
catcgaagtttgtatttttatacactcataagattcca--acacagtttcgacatgatttactttttggagtgtggacttccaacgaaacatgttaacct |
198 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9047778 |
catcgaagtttgtattttcatacactactaagattccaacacacagtttcgacatgatttactttttggagtgtggacttccaacgaaacatgttaacct |
9047877 |
T |
|
| Q |
199 |
tatcatgatgcatgtgattcatattat |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9047878 |
tatcatgatgcatgtgattcatattat |
9047904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University