View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10251_low_9 (Length: 232)
Name: NF10251_low_9
Description: NF10251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10251_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 20713339 - 20713515
Alignment:
| Q |
1 |
ttcctcgtcttcttcacgttcatcgtcgccgtcgacgccgttctccggtggaatcggggccattcggattgttattcccggtggcttcgtcgtcggaaaa |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20713339 |
ttcctcgtcttcttcgcgttcatcgtcgccgtcgacgccgttctccggtggaatcggtgccattcggattgttattcccggtggcttcgtcgtcggaaaa |
20713438 |
T |
 |
| Q |
101 |
gtttgtttaacggtgaaaatttggaaattgcgttgtggcgcagatctgtttcgttgcgctgggaaaatgttcccacg |
177 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20713439 |
gtttgtttaacggtgaaaaattggaaattgcgttgtagcgcagatctgtttcgttgcgctgggaaaatgttcccacg |
20713515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University