View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10253_high_2 (Length: 319)
Name: NF10253_high_2
Description: NF10253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10253_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 7057168 - 7057476
Alignment:
| Q |
1 |
gcatttaagaaaatgcaagatgttcaggatggtgtgaaagattatgatatggctagtcctcattcatcaccattgagcttcccctttgctaagattatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7057168 |
gcatttaagaaaatgcaagatgttcaggatggtgtgaaagattatgatatggctagtcctcattcatcaccattgagcttcccttttgctaagattatgc |
7057267 |
T |
 |
| Q |
101 |
ctgaaccgcaacatacaataattagcagcttgaagagtaccaattcttatatcaatgttggagcctcaccaaagagaaactcacactctaatgtcgatat |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7057268 |
ctgaaccgcaacatacaataattggcagcttgaagagtaccaattcttatatcaatgttggagcctcaccaaagagaaactcacactctaatgtcgatat |
7057367 |
T |
 |
| Q |
201 |
caggccatcggagattataccaaaaactgttccaccagaaatttcattagctaataatttttctttgccacctcctgcggcccagagtgtatccaaggac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7057368 |
caggccatcggagattataccaaaaactgttccaccagaaatttcattagctaataatttttctttgccacctcctgcggcccagagtgtatccaaggac |
7057467 |
T |
 |
| Q |
301 |
gagtctctg |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
7057468 |
gagtctctg |
7057476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University