View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10254_low_16 (Length: 276)
Name: NF10254_low_16
Description: NF10254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10254_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 32162647 - 32162396
Alignment:
| Q |
1 |
gggtggtgtcgggaggatggccggagatgatgagggaagcgtggagggttttgacggtggtgggatgtttgcagatacgtgagaggtggatagttggagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162647 |
gggtggtgtcgggaggatggccggagatgatgagggaagcgtggagggttttgacggtggtgggatgtttgcagatacgtgagaggtggatagttggagg |
32162548 |
T |
 |
| Q |
101 |
gagtggaactggaaggtggttgttgggtgtatggtggtggtaactgtagtggtgataggtgaagaagctccattttttgcagtgaagacgatgaagaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162547 |
gagtggaactggaaggtggttgttgggtgtatggtggtggtaactgtagtggtgataggtgaagaagctccattttttgcagtgaagacgatgaagaatt |
32162448 |
T |
 |
| Q |
201 |
cttggtgtgatcatcaatcaacattggttcatcacattttctttgaggggttccaat |
257 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
32162447 |
cttggtgtgatcatcaa----cat-ggttcatcatattttctttgaggggttccaat |
32162396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University