View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10254_low_17 (Length: 236)
Name: NF10254_low_17
Description: NF10254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10254_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 50764218 - 50764424
Alignment:
| Q |
14 |
cataggggtcaaaagtgcaattaagccttctttttatgattgtgcttcagtttactcccgcaaccagtatggccaaggttatcggtcccttggtttctgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50764218 |
cataggggtcaaaagtgcaattaagccttctttttatgattgtgcttcagtttattcccgcaaccagtatggccaaggttatcggtcccttggtttctgt |
50764317 |
T |
|
| Q |
114 |
ttttgtaatatatgttacataaggtgatgtttctcactatgtggaactattaaaaaactataactatggcatactatttctctttggctagtaatgtgct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50764318 |
ttttgtaatatatgttacataaggtgatgtttctcactatgtggaactattaaaaaactataactatggcatactatttctctttggctcgtaatgtgct |
50764417 |
T |
|
| Q |
214 |
ttgtatt |
220 |
Q |
| |
|
||||||| |
|
|
| T |
50764418 |
ttgtatt |
50764424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 41 - 159
Target Start/End: Complemental strand, 5805990 - 5805868
Alignment:
| Q |
41 |
ttctttttatgattgtgcttcagtttactcccgcaaccagtatggc-----caaggttatcggtcccttggtttctgtttttgtaatatatgttacataa |
135 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | ||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
5805990 |
ttctttttatgattgtaattcagtttactcca-ctaccagtatggcatggccaaggttatcggtcccttggtttccgttttggtaatatatgttacataa |
5805892 |
T |
|
| Q |
136 |
ggtgatgtttctcactatgtggaa |
159 |
Q |
| |
|
|||||||||||||| || |||||| |
|
|
| T |
5805891 |
ggtgatgtttctcattaagtggaa |
5805868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 53
Target Start/End: Complemental strand, 52310827 - 52310788
Alignment:
| Q |
15 |
ataggggtc-aaaagtgcaattaagccttctttttatgat |
53 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52310827 |
ataggggtccaaaagtgcaattaagccttctttttatgat |
52310788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Original strand, 50591795 - 50591829
Alignment:
| Q |
17 |
aggggtcaaaagtgcaattaagccttctttttatg |
51 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
50591795 |
aggggtcaaaagtgcaattaagccttatttttatg |
50591829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 48
Target Start/End: Complemental strand, 26932608 - 26932575
Alignment:
| Q |
15 |
ataggggtcaaaagtgcaattaagccttcttttt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
26932608 |
ataggggtcaaaagtgcaattaagcctttttttt |
26932575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 51
Target Start/End: Original strand, 26171494 - 26171531
Alignment:
| Q |
15 |
ataggggtc-aaaagtgcaattaagccttctttttatg |
51 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26171494 |
ataggggtccaaaagtgcaattaagccttctttttatg |
26171531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University