View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10254_low_18 (Length: 222)
Name: NF10254_low_18
Description: NF10254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10254_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 7795655 - 7795482
Alignment:
| Q |
16 |
cagagataagagggagagagtccctgcaaccatatccagccaaagcagtgtcaccgtctctccattgtgttgtgtcattcgggaataacgagtgtacgag |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7795655 |
cagagataagatggagagagtccctgcaaccatagccagccaaaccagcgtcaccgtctctccattgtgttgtgtcattcgggaataacgagtgtacgag |
7795556 |
T |
|
| Q |
116 |
aaaccaggtgttcgtttgggcgctggtagtccaacacttctgtttttctgtcttccgatttatctcttccctct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7795555 |
aaaccaggtgttcgtttgggcgctggtagtccaacacttctgtttttctgtcttccgatttatctcttctctct |
7795482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 7802535 - 7802607
Alignment:
| Q |
31 |
gagagtccctgcaaccatatccagccaaagcagtgtcaccgtctctccattgtgttgtgtcattcgggaataa |
103 |
Q |
| |
|
|||| |||||||||||| | ||||||||||||| | |||| ||||||||||||||||| | ||| |||||||| |
|
|
| T |
7802535 |
gagattccctgcaaccacagccagccaaagcagcgccaccatctctccattgtgttgtataatttgggaataa |
7802607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University