View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10255_low_3 (Length: 238)
Name: NF10255_low_3
Description: NF10255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10255_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 26 - 225
Target Start/End: Complemental strand, 39319017 - 39318818
Alignment:
| Q |
26 |
gaggaaggcttgattttcgagttgttagttgtttgaatgggaaccttacgaagcggtgtgccatcaatgtctatctttgtctattatgtgtcgttaggaa |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39319017 |
gaggaaggcttgattttcgagttgttagttgtttgaatgggaaccttacgaagcggtgtgccatcaatgtctatctttgtctattatgtgtcgttaggac |
39318918 |
T |
|
| Q |
126 |
gtttgagagtgaatggtccttggttagtcgttggaggcatttgggaagcaggatggatccaaggttgttgacttggttcgatgattgagtttggcctatg |
225 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39318917 |
gtttgagagtgaacggtccttggttagtcgttggaggcatttgggaagcaggatggatccaaggttgttgacttggttcgatgattgagtttggcctatg |
39318818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University