View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10256_5 (Length: 348)
Name: NF10256_5
Description: NF10256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10256_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 45561191 - 45561528
Alignment:
| Q |
1 |
gatgtgggatttaacttcttaaatggttcattgccatcaagtttgcagaggtggacaaggctaaacacattaattttgactgagaatcattttagtggcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45561191 |
gatgtgggatttaacttcttaaatggttcattgccatcaagtttgcagaggtggacaaggctaaacacattaattttgactgagaatcattttagtggcg |
45561290 |
T |
 |
| Q |
101 |
gcattccagatttcttgtcggcattcaaagatctttctgaactacggcttggtggaaatatgtttggtgggagaattcctagatcggttggggcattgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45561291 |
gcattccagatttcttgtcggcattcaaagatctttctgaactacggcttggtggcaatatgtttggtgggagaattcctagatcggttggggcattgca |
45561390 |
T |
 |
| Q |
201 |
gaatttgatctatggtttgaatctaagttctaatgggctgataggcgacattcctgtggaaatcggaaaactgaaaactttgcaattgctggatctatct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45561391 |
gaatttgatctatggtttgaatctaagttctaatgggctgataggcgacattcctgtggaaattggaaaactgaaaactttgcaattgctggatctatct |
45561490 |
T |
 |
| Q |
301 |
cataacaatttgacaggaagcatacaggttcttgatga |
338 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45561491 |
cagaacaatttgacaggaagcatacaggttcttgatga |
45561528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University