View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10257_3 (Length: 389)
Name: NF10257_3
Description: NF10257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10257_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 205 - 384
Target Start/End: Original strand, 51015215 - 51015394
Alignment:
| Q |
205 |
atatcaaatacaagaatttagtaaagattgaattgagaatgagaagtactacgtaccaagaacatctccacggctaaagttgtatctctctgcccaagta |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51015215 |
atatcaaatacaagaatttagtaaagattgaattgagaatgagaagtactacgtaccaagaacatctccacggctaaagttgtatctctctgcccaagta |
51015314 |
T |
|
| Q |
305 |
gcataatttgtttggctactccattcatcttgatcaccaacagcataaacactagccatgacacagttcaagagaaaact |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51015315 |
gcataatttgtttggctactccattcatcttgatcaccaacagcataaacactagccatgacacagttcaagagaaaact |
51015394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 104 - 177
Target Start/End: Original strand, 51015109 - 51015182
Alignment:
| Q |
104 |
acaaatataaggactttattttttaaagataatgttatgaacttatgatcacatacgaatatcttttattggcg |
177 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51015109 |
acaaatatatggactttattttttaaagataatgttatgaacttatgatcacatacgaatatcttttattggcg |
51015182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University