View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10258_high_10 (Length: 252)
Name: NF10258_high_10
Description: NF10258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10258_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 47509542 - 47509765
Alignment:
| Q |
16 |
accaacatgattagtggctgc---ctttgagttgcatttgggcatatcaaagggattttaggcttttagcgaccaagtaaattgggtgggtttagtggca |
112 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| || |
|
|
| T |
47509542 |
accaacatgattagtggctgctgcctttgagttgcatttgggcatatcaaagggattttagcc--------accaagtaaattgggtgggtttagtg-ca |
47509632 |
T |
|
| Q |
113 |
tattgaacccaaatagagccgacaccactgcccactcatctcctcccaacttccaccaata------catcataatcagattgttcgattccaatctttt |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47509633 |
tattgaacccaaatagagccaacaccactgcccactcatctcc---caacttccaccaatattaatacatcataatcagattgttcgattccaatctttt |
47509729 |
T |
|
| Q |
207 |
tggttcctcattaaccacaagctccacagcttcatc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47509730 |
tggttcctcattaaccacaagctccacagcttcatc |
47509765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University