View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10258_high_15 (Length: 215)
Name: NF10258_high_15
Description: NF10258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10258_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 24348968 - 24349148
Alignment:
| Q |
15 |
ataggttggactgaaatactacttcaattgcaagatataaggtaagtcaaacaaaatcgatgtatttgattaaaaatttcttctagtaaaaactaatctt |
114 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
24348968 |
ataggttggattgaaatactactccaattgcaagatataaggcaagtcaaacaaaaccgatgtatttgattaaaagtttcttctggtaaaaactaatctt |
24349067 |
T |
 |
| Q |
115 |
atagttttgatttaaaagttgacgggtttcttatagagcgaaaatcaattgcataagtataatctccatagatttcatccg |
195 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24349068 |
atagttttgatttaaaagttaacgggtttcttatagagcgaaagtcaattgcataagtataatctccatagatttcatccg |
24349148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 58 - 93
Target Start/End: Original strand, 32600019 - 32600054
Alignment:
| Q |
58 |
aagtcaaacaaaatcgatgtatttgattaaaaattt |
93 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32600019 |
aagtcaaacaaaatcgatgtatttgtttaaaaattt |
32600054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University