View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10258_low_14 (Length: 322)
Name: NF10258_low_14
Description: NF10258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10258_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 28 - 305
Target Start/End: Original strand, 7156641 - 7156918
Alignment:
| Q |
28 |
gcatatttatttcttcatggtatcattaaccggagtctctgtaactttaggaagtagccctttttctctgcaggtttctatagctcctgtgaacatgtct |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156641 |
gcatatttatttcttcatggtatcattaaccggagtctctgtaactttaggaagtagccctttttctctgcaggtttctatagctcctgtgaacatgtct |
7156740 |
T |
 |
| Q |
128 |
tctaagctgtatttaaatataaaccccaagtctgtgatcttctttgaagaaaatttgataatttccagatcatctgggatatccttgaatctaaaaatcc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156741 |
tctaagctgtatttaaatataaaccccaagtctgtgatcttctttgaagaaaatttgataatttccagatcatctgggatatccttgaatctaaaaatca |
7156840 |
T |
 |
| Q |
228 |
aatgcacaaacttagcacaaaaaatatttttcctattatatcttactcttctaagtgaacaatagttaatattacaaa |
305 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156841 |
aatgcacaaacttagcacaacaaatatttttcctattatatcttactcttctaagtgaacaatagttaatattacaaa |
7156918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 73 - 230
Target Start/End: Original strand, 7164319 - 7164476
Alignment:
| Q |
73 |
tttaggaagtagccctttttctctgcaggtttctatagctcctgtgaacatgtcttctaagctgtatttaaatataaaccccaagtctgtgatcttcttt |
172 |
Q |
| |
|
||||||||| |||||||||||| |||| || || || ||| | ||| |||| || || |||||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
7164319 |
tttaggaagaagccctttttctatgcatgtatcaattgcttcagtgtacatatcctccaagctgtatttaaactcgaatcccaagtctttgatcttcttt |
7164418 |
T |
 |
| Q |
173 |
gaagaaaatttgataatttccagatcatctgggatatccttgaatctaaaaatccaat |
230 |
Q |
| |
|
|| |||||| | | || |||| |||||||| |||| ||||| ||||||||||||| |
|
|
| T |
7164419 |
gatgaaaatctcacaagctccaattcatctggaatattattgaacctaaaaatccaat |
7164476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University