View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10258_low_21 (Length: 255)
Name: NF10258_low_21
Description: NF10258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10258_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 5 - 245
Target Start/End: Complemental strand, 32540303 - 32540063
Alignment:
| Q |
5 |
tgtaactaaaaggagttcttaaggtggaattctcccaaggtaaatgaacaaaatgtacattgtgtttaggccacgccatccatcgttaagtccccttatg |
104 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32540303 |
tgtaactaaaaggggttcttaaggtggaatcctcccaaggtaaatgaacaaaatgtacattgtgtttaggccacaccatccatcgttaagtccccttatg |
32540204 |
T |
 |
| Q |
105 |
aaacttgaaacaatttccaggagattatcggcaaaagaagagtttgagaatttcaaccccttctcgatgacttgctatttagtcatgatggcaactgttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32540203 |
aaacttgaaacaatttccaggagattatcggcaaaagaagagtttgagaatttcaatcccttctcgatgacttgctatttagtcatgatggcaactgttt |
32540104 |
T |
 |
| Q |
205 |
ttcagtcttaaccttctggttccgaagagaagaggtctctg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32540103 |
ttcagtcttaaccttctggttccgaagagaagaggtctctg |
32540063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University