View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10258_low_24 (Length: 251)
Name: NF10258_low_24
Description: NF10258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10258_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 16005667 - 16005916
Alignment:
| Q |
1 |
atgcatgatgggttagcagctggtcaacttgctcaagatgaaaatgcacagattgcacatgatgttggggcaaatcaagcacaagaagttgcagaaaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16005667 |
atgcatgatgggttagcagctggtcaacttgctcaagatgaaaatgcacagattgcacatgttgttggggcaaatcaagcacaagaagttgtagaaaatc |
16005766 |
T |
 |
| Q |
101 |
ttgacgcagaagaaaatgcac---------------aggtagaacaagctgaagaagttgcacagaatctggaggctgaacaagatgaagtttgatttga |
185 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16005767 |
ttgaggcagaagaaaatgcacaggttgatgatattgaggtagaacaagctgaagaagttgcacagaatctggaggctgaacaagatgaagtttgatttga |
16005866 |
T |
 |
| Q |
186 |
tattttttccatgactttactttagtttctttcccgagagatatttgtgc |
235 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16005867 |
tatttttgccatgactttactttagtttctttcccaagagatatttgtgc |
16005916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University