View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10258_low_3 (Length: 469)

Name: NF10258_low_3
Description: NF10258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10258_low_3
NF10258_low_3
[»] chr6 (1 HSPs)
chr6 (118-147)||(34276813-34276842)


Alignment Details
Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 118 - 147
Target Start/End: Complemental strand, 34276842 - 34276813
Alignment:
118 cgcagtttgttaatttcgatttggaatgca 147  Q
    ||||||||||||||||||||||||||||||    
34276842 cgcagtttgttaatttcgatttggaatgca 34276813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University