View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10258_low_30 (Length: 217)
Name: NF10258_low_30
Description: NF10258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10258_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 204
Target Start/End: Complemental strand, 530596 - 530400
Alignment:
| Q |
8 |
gaaagttccttcctttgtttcttgcattgacgaaccttaactcgctgaatcctacaatccgaaaatgaaacaccgtcttcgtgtttcctgttatcagatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
530596 |
gaaagttccttcctttgtttcttgcattgacgaaccttaactcgctgaatcctacaatccgaaaatgaaacaccgtcttcgtgtttcctgttatcagatt |
530497 |
T |
 |
| Q |
108 |
ctccttgttgtacatccatcatgcatgtcattgaacgcaattttcttaaccaactctttttaaccctctttgtccacggctcaaacacacctgtctc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
530496 |
ctccttgttgtacatccatcatgcatgtcattgaacgcaattttcttaaccaactctttttaaccctctttgtccacggctcaaacacaccggtctc |
530400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University