View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10258_low_4 (Length: 414)
Name: NF10258_low_4
Description: NF10258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10258_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 7e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 20 - 247
Target Start/End: Complemental strand, 3855120 - 3854900
Alignment:
| Q |
20 |
cacaagtagcggtacaaacacccttgaaattgtttaactatgtcacgccagtacagacaactcagtttttcaatttaactcgtgtggagcttagctttga |
119 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3855120 |
cacaagtagcggtacgaaaacccttgaaattgtttaactatgtcgcgccagtacagacaactcagtttttcaatttaactcatgtggagcttagctttga |
3855021 |
T |
|
| Q |
120 |
gaaaagaggatgaggaatattattatcattatcgttgggattggttgaagaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggt |
219 |
Q |
| |
|
| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3855020 |
g-aaagaggatgaggaatatt------attgtcgttgggattggttgaagaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggt |
3854928 |
T |
|
| Q |
220 |
ttgttaactttatcatattaacaacaac |
247 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
3854927 |
ttgttaactttatcatattagcaacaac |
3854900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 326 - 404
Target Start/End: Complemental strand, 3854833 - 3854755
Alignment:
| Q |
326 |
ggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatgcctttg |
404 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
3854833 |
ggaggaggaggctatggatcaagcgttgatgatcataattcattgcatccacaatttgtccccaactgcaatgtctttg |
3854755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 93; Significance: 4e-45; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 79 - 239
Target Start/End: Original strand, 4141580 - 4141730
Alignment:
| Q |
79 |
actcagtttttcaatttaactcgtgtggagcttagctttgagaaaagaggatgaggaatattattatcattatcgttgggattggttgaagaagttcatc |
178 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
4141580 |
actcagtttttcaatttaactcatatggagcttagctttgagaag-gaggatgaggaatattatcat---------tgggattggttgaagaaattcatc |
4141669 |
T |
|
| Q |
179 |
cgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatatta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
4141670 |
cgcgcctgcccctctcttcaaagtattgtgattcataaggtttgttaactctatcatatta |
4141730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 321 - 404
Target Start/End: Original strand, 4141819 - 4141902
Alignment:
| Q |
321 |
tcggaggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatgcctttg |
404 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4141819 |
tcggaggaggagtaggttatggattaagcggcgatgatcataattcattgcatccacaatttgtccccaactgcaatgcctttg |
4141902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 20 - 74
Target Start/End: Original strand, 4141503 - 4141557
Alignment:
| Q |
20 |
cacaagtagcggtacaaacacccttgaaattgtttaactatgtcacgccagtaca |
74 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
4141503 |
cacaagtcgcggtacaaacacccttgaaattgtttgactatgtcgcaccagtaca |
4141557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University