View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_high_12 (Length: 246)
Name: NF10259_high_12
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 172 - 222
Target Start/End: Complemental strand, 31405948 - 31405898
Alignment:
| Q |
172 |
ttgttcatccaaaattcacttattagtagggttagagtgcacaccattgtt |
222 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
31405948 |
ttgttcttccaaaatgcacttattagtagggttagagtgcacaccaatgtt |
31405898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 100
Target Start/End: Original strand, 2591599 - 2591627
Alignment:
| Q |
72 |
agaacagacaatgaaataaaaaactattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2591599 |
agaacagacaatgaaataaaaaactattg |
2591627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University