View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_high_19 (Length: 208)
Name: NF10259_high_19
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_high_19 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 17976693 - 17976900
Alignment:
| Q |
1 |
aagtggcgggaagattaatttcgcgcattccactggcacggagaatgcaccgccattgttagcatcagatggggggagaggcttggaataggaaacaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
17976693 |
aagtggcgggaagattaatttcgcgcattccactggcacagagaatgcaccgccattgttagcatcagatggggtgagagtcttggaataggaaacaacc |
17976792 |
T |
 |
| Q |
101 |
tttttgtcatcatctttgtcttcacgaacctcaagagaccgaggttcgtgaacacctttgttagtgaccggannnnnnnnnagtttgacgaagactttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||| || |
|
|
| T |
17976793 |
tttttgtcatcatctttgtcttcacgaacctcaagagagtgaggttcgtgaacacctttgttagtgacaggagtgaggagtagtttgacgaagacttcat |
17976892 |
T |
 |
| Q |
201 |
cgggacaa |
208 |
Q |
| |
|
||| |||| |
|
|
| T |
17976893 |
cggtacaa |
17976900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 17914466 - 17914398
Alignment:
| Q |
1 |
aagtggcgggaagattaatttcgcgcattccactggcacggagaatgcaccgccattgttagcatcaga |
69 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||| |||||||||||||| || ||||||||||| |
|
|
| T |
17914466 |
aagtggcgggaagattaattttgcgcattcgctaggcactgagaatgcaccgccgttattagcatcaga |
17914398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 35273418 - 35273353
Alignment:
| Q |
1 |
aagtggcgggaagattaatttcgcgcattccactggcacggagaatgcaccgccattgttagcatc |
66 |
Q |
| |
|
|||||||||||| || |||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
35273418 |
aagtggcgggaatatcaatttcgcgcattcagaaggtacggagaatgcaccgccattattagcatc |
35273353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University