View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_high_3 (Length: 355)
Name: NF10259_high_3
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_high_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 160 - 355
Target Start/End: Original strand, 40184205 - 40184400
Alignment:
| Q |
160 |
tgttgaccttggaggagcagaaccagcattgagactgcgatgaagaatcctagcaggagcagcatcatcagcatcagtgtcaacatcagcaatcaaatct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40184205 |
tgttgaccttggaggagcagaaccagcattgagactgcgatgaagaatcctagcaggagcagcatcatcagcatcagtgtcaacatcagcaatcaaatct |
40184304 |
T |
 |
| Q |
260 |
ttcaaacccatactgacaacatcagcttcatcatcaacttcatcttcatctccaactggtgatggatagggacgcaccaaaggttttggcgcagtc |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
40184305 |
ttcaaacccatactgacaacatcagcttcatcatcaacttcatcttcatctccaactggtgatgaataaggacgcaccaaaggttttggcgcagtc |
40184400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University